Pedido rápido

Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano RGS5 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC030059
    Tamaño de cDNA:546bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    Sinónimo de gen:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    Especie:Human
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15234-ACG$225
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15234-ACR$225
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15234-ANG$225
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15234-ANR$225
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15234-CF$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15234-CH$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15234-CM$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15234-CY$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(Vector de expresión)HG15234-G$75
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15234-NF$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15234-NH$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15234-NM$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15234-NY$195
    Humano RGS5 / Regulator of G-protein signaling 5 clonación del ADN o clonación génica(vector de clonación)HG15234-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"