Relaxin 1 / RLN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

Relaxin 1 / RLN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Human relaxin 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Relaxin 1 / RLN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

bA12D24.3.1 cDNA ORF Clone, Human; bA12D24.3.2 cDNA ORF Clone, Human; H1 cDNA ORF Clone, Human; H1RLX cDNA ORF Clone, Human; RLN1 cDNA ORF Clone, Human; RLXH1 cDNA ORF Clone, Human

Relaxin 1 / RLN1 Background Information

Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to theinsulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 8 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.
Full Name
relaxin 1
References
  • Bathgate,R.A. et al., 2003, ends Endocrinol Metab  14 (5):207-13.
  • Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.
  • Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.
  • Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.
  • Samuel,C.S. et al., 2007, Adv Exp Med Biol  612: 88-103.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait