Pedido rápido

Humano ROR2 clonación del ADN o clonación génica(vector de clonación)

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
Hoja de datosReseñasProductos relacionadosProtocolos
Humano ROR2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004560.3
Tamaño de cDNA:2832bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens receptor tyrosine kinase-like orphan receptor 2.
Sinónimo de gen:BDB, BDB1, NTRKR2
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ROR2
Sitio de restricción:KpnI + XbaI(6.1kb+2.83kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 276C/T,2088C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano ROR2 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG16133-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"