After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano FTLS / RSPO2 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RSPO2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_178565.4
Tamaño de cDNA:732bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens R-spondin 2 homolog (Xenopus laevis) with N terminal Myc tag.
Sinónimo de gen:CRISTIN2, MGC35555, MGC43342, RSPO2
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fondo

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Referencias
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • Size / Price
    Catálogo: HG13084-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"