Pedido rápido

Text Size:AAA

Humano RTN3 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Humano RTN3 Información de producto de clon de cDNA
Gene_bank_ref_id:BC000634
Tamaño de cDNA:711bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens reticulon 3.
Sinónimo de gen:HAP, ASYIP, NSPL2, NSPLII, RTN3-A1, RTN3
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RTN3 qPCR primers for gene expression analysis, HP102909 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: HG14259-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"