After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human RAF1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_002880.3
Tamaño de cDNA:1947bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1.
Sinónimo de gen:NS5, CRAF, Raf-1, c-Raf
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RAF1
Sitio de restricción:KpnI + XbaI (6.1kb + 1.95kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human RAF1 Gene Plasmid Map
Human Raf-1 natural ORF mammalian expression plasmid
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10657-ACG$245
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10657-ACR$245
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10657-ANG$245
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10657-ANR$245
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10657-CF$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10657-CH$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10657-CM$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10657-CY$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(Vector de expresión)HG10657-M$75
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10657-NF$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10657-NH$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10657-NM$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10657-NY$215
Humano Raf-1/RAF1 clonación del ADN o clonación génica(vector de clonación)HG10657-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10657-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human Raf-1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"