RAF1 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

RAF1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1947 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-raf-1 murine leukemia viral oncogene homolog 1.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.95kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAF1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAF1 cDNA ORF Clone, Human, untagged: Validated Images

RAF1 cDNA ORF Clone, Human, untagged: Alternative Names

c-Raf cDNA ORF Clone, Human; CMD1NN cDNA ORF Clone, Human; CRAF cDNA ORF Clone, Human; NS5 cDNA ORF Clone, Human; Raf-1 cDNA ORF Clone, Human

RAF1 Background Information

RAF1 gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2.
Full Name
Raf-1 proto-oncogene, serine/threonine kinase
References
  • Zhang K, Chen H, Zhang B, et al. Overexpression of Raf-1 and ERK1/2 in sacral chordoma and association with tumor recurrence. International Journal of Clinical and Experimental Pathology. 2015;8(1):608-614.
Add to Cart Successfully Add to Cart Failed