Pedido rápido

Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human S100A10 Información de producto de clon de cDNA
Tamaño de cDNA:294bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A10 with C terminal HA tag.
Sinónimo de gen:42C, P11, p10, GP11, ANX2L, CAL1L, CLP11, Ca[1], ANX2LG, MGC111133, S100A10
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11144-ACG$225
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11144-ACR$225
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11144-ANG$225
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11144-ANR$225
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11144-CF$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11144-CH$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11144-CM$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11144-CY$195
Humano S100A10 clonación del ADN o clonación génica(Vector de expresión)HG11144-M$75
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11144-M-F$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11144-NF$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11144-NH$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11144-NM$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11144-NY$195
Humano S100A10 clonación del ADN o clonación génica(vector de clonación)HG11144-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  
Protein S100-A10, also known as Calpactin I light chain, Cellular ligand of annexin II, S100 calcium-binding protein A10, p10 protein, p11, ANX2LG and S100A10, is a member of the S100 family of small, dimeric EF hand-type Ca(2+)-binding proteins that generally modulate cellular target proteins in response to intracellular Ca(2+) signals. In contrast to all other S100 proteins, S100A10 is Ca(2+) insensitive because of amino acid replacements in its Ca(2+)-binding loops that lock the protein in a permanently active state. S100A10 forms a heterotetramer with annexin IIH and promotes carcinoma invasion and metastasis by plasminogen activation. S100A10 and annexin II contribute to the aggressive characteristics of anaplastic carcinoma, while playing a constitutive role in papillary carcinoma. S100A10 induces the dimerization of ANXA2 / p36, it may function as a regulator of protein phosphorylation in that the ANXA2 monomer is the preferred target of tyrosine-specific kinase. S100A10 functions as a linker tethering certain transmembrane proteins to annexin A2 thereby assisting their traffic to the plasma membrane and/or their firm anchorage at certain membrane sites.

  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Ito,Y. et al., 2007, Anticancer Res. 27 (4C):2679-83.
  • Svenningsson,P. et al., 2007, Curr Opin Pharmacol  7 (1):27-32.
  • Rescher,U. et al., 2008, Pflugers Arch. 455 (4):575-82.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catálogo: HG11144-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.