After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human S100A16 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_080388.1
Tamaño de cDNA:312bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A16 with C terminal HA tag.
Sinónimo de gen:AAG13, S100F, DT1P1A7, MGC17528, S100A16
Especie:Human
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11137-ACG$225
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11137-ACR$225
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11137-ANG$225
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11137-ANR$225
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11137-CF$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11137-CH$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11137-CM$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11137-CY$195
Humano S100A16 clonación del ADN o clonación génica(Vector de expresión)HG11137-M$75
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11137-M-F$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11137-NF$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11137-NH$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11137-NM$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11137-NY$195
Humano S100A16 clonación del ADN o clonación génica(vector de clonación)HG11137-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

S100A16 is a member of S100 protein super family that carries calcium-binding EF-hand motifs. S100 proteins are cell- and tissue-specific and are involved in many intra- and extracellular processes through interacting with specific target proteins. S100A16 expression was found to be astrocyte-specific. The S100A16 protein was found to accumulate within nucleoli and to translocate to the cytoplasm in response to Ca(2+) stimulation. The homodimeric structure of human S100A16 in the apo state has been obtained both in the solid state and in solution, resulting in good agreement between the structures with the exception of two loop regions. The homodimeric solution structure of human S100A16 was also calculated in the calcium(II)-bound form. Differently from most S100 proteins, the conformational rearrangement upon calcium binding is minor. Immunoprecipitation analysis revealed that S100A16 could physically interact with tumor suppressor protein p53, also a known inhibitor of adipogenesis. Overexpression or RNA interference-initiated reduction of S100A16 led to the inhibition or activation of the expression of p53-responsive genes, respectively. S100A16 protein is a novel adipogenesis-promoting factor.

Referencias
  • Sturchler E, et al. (2006) S100A16, a novel calcium-binding protein of the EF-hand superfamily. J Biol Chem. 281(50): 38905-17.
  • Liu Y, et al. (2011) Identification of S100A16 as a Novel Adipogenesis Promoting Factor in 3T3-L1 Cells. Endocrinology. 152(3): 903-11.
  • Babini E, et al. (2011) Structural characterization of human S100A16, a low-affinity calcium binder. J Biol Inorg Chem. 16(2): 243-56.
  • Size / Price
    Catálogo: HG11137-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"