After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human S100A3 Información de producto de clon de cDNA
Tamaño de cDNA:306bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A3 with C terminal HA tag.
Sinónimo de gen:S100E, S100A3
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11136-ACG$225
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11136-ACR$225
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11136-ANG$225
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11136-ANR$225
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11136-CF$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11136-CH$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11136-CM$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11136-CY$195
Humano S100A3 clonación del ADN o clonación génica(Vector de expresión)HG11136-M$75
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11136-M-F$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11136-NF$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11136-NH$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11136-NM$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11136-NY$195
Humano S100A3 clonación del ADN o clonación génica(vector de clonación)HG11136-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Protein S100-A3, also known as Protein S-100E, S100 calcium-binding protein A3, S100A3 and S100E, is a member of the S-100 family. S100A3 / S100E contains 2 EF-hand domains. S100A3 / S100E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S100A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S100A3 / S100E is a unique member of the Ca2+-binding S100 protein family with the highest cysteine content and affinity for Zn2+. S100A3 / S100E binds both calcium and zinc. S100A3 / S100E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S100A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S100A3 / S100E is a unique protein among all members of the calcium-binding S100 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S100A3 / S100E is released from hair fibers and possibly destabilizes the hair tissue architecture.

  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
  • Size / Price
    Catálogo: HG11136-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.