Pedido rápido

Text Size:AAA

Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human S100A5 Información de producto de clon de cDNA
Tamaño de cDNA:333bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens S100 calcium binding protein A5 with C terminal HA tag.
Sinónimo de gen:S100D, S100A5
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11142-ACG$225
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11142-ACR$225
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11142-ANG$225
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11142-ANR$225
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11142-CF$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11142-CH$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11142-CM$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11142-CY$195
Humano S100A5 clonación del ADN o clonación génica(Vector de expresión)HG11142-M$75
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11142-NF$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11142-NH$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11142-NM$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11142-NY$195
Humano S100A5 clonación del ADN o clonación génica(vector de clonación)HG11142-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

S100 protein?is a family of low molecular weight protein found in vertebrates characterized by two?EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is?100%?soluble in ammonium sulfate?at neutral?pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the?neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.?? Protein S100-A5, also known as Protein S-100D, S100 calcium-binding protein A5, S100A5 and S100D, is a member of the S100 family which contains two?EF-hand domains. S100A5 is also a novel member of the EF-hand superfamily of calcium-binding proteins that is poorly characterized at the protein level. It is expressed in very restricted regions of the adult brain. From birth onwards, S100A5 remained a neuronal-specific protein, only located in a subpopulation of neurons in the spiral ganglion.

  • Sch?fer,B.W. et al., 2000, J Biol Chem. 275 (39):30623-30.
  • Gebhardt, C. et al., 2006, Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008, J Immunol. 181 (8): 5627-36.
  • Heibeck TH. et al., 2009, J. Proteome Res. 8:3852-61.
  • Size / Price
    Catálogo: HG11142-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.