Pedido rápido

Text Size:AAA

Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human RPS6KB1 Información de producto de clon de cDNA
Tamaño de cDNA:1578bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 with N terminal His tag.
Sinónimo de gen:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10099-ACG$245
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10099-ACR$245
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10099-ANG$245
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10099-ANR$245
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10099-CF$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10099-CH$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10099-CM$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10099-CY$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(Vector de expresión)HG10099-M$75
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10099-NF$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10099-NH$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10099-NM$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10099-NY$215
Humano PS6K / RPS6KB1 clonación del ADN o clonación génica(vector de clonación)HG10099-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • Size / Price
    Catálogo: HG10099-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.