Pedido rápido

Humano SCG2 / Secretogranin II clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SCG2 Información de producto de clon de cDNA
Tamaño de cDNA:1854bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens secretogranin II (chromogranin C) with C terminal HA tag.
Sinónimo de gen:SN, CHGC, SgII, SCG2
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano SCG2 / Secretogranin II clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Product nameProduct name

Kit ligand, also known as Hematopoietic growth factor KL, Mast cell growth factor, Steel factor, Stem cell factor, c-Kit ligand, Kitlg and KITL, is a single-pass type I membrane protein which belongs to the SCF family. KITL / kit ligand also belongs to the family of dimeric transmembrane growth factors. The soluble form of KIT ligand is a secreted protein. Mast cells are thought to participate in a variety of immune responses, such as parasite resistance and the allergic reaction. Mast cell development depends on stem cell factor (Kit ligand) and its receptor, c-Kit. KITL / kit ligand stimulates the proliferation of mast cells. KITL / kit ligand is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. Efficient cell surface presentation of KITL / kit ligand is essential for the migration, proliferation, and survival of melanocytes, germ cells, hemopoietic stem cells, and mastocytes. KITL / kit ligand acts synergistically with other cytokines, probably interleukins. KITL / kit ligand plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin. It exerts permanent survival, proliferation and migration functions in Kit receptor-expressing melanocytes. KITL / kit ligand misexpression in some hyperpigmented lesions may open the avenue for Kitl-dependent treatment of pathological skin conditions.

  • Nishida, al., 2002, Blood. 99 (5):1866-9.
  • Paulhe,F. et al., 2004,J Biol Chem. 279 (53):55545-55.
  • Fernandez,S.M. et al., 2008,Biol Reprod. 79 (2):318-27.
  • Wehrle-Haller,B. et al., 2003,Pigment Cell Res.16 (3):287-96.
  • Size / Price
    Catálogo: HG13441-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.