Pedido rápido

Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SEMA3A Información de producto de clon de cDNA
Tamaño de cDNA:2316bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A with N terminal His tag.
Sinónimo de gen:SemD, SEMA1, SEMAD, SEMAL, coll-1, Hsema-I, SEMAIII, Hsema-III, MGC133243, SEMA3A
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10758-ACG$245
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10758-ACR$245
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10758-CF$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10758-CH$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10758-CM$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10758-CY$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(Vector de expresión)HG10758-M$75
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación)HG10758-M-N$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10758-NF$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10758-NH$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10758-NM$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10758-NY$215
Humano Semaphorin 3A/SEMA3A clonación del ADN o clonación génica(vector de clonación)HG10758-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Semaphorins are a family of secreted and cell-bound signaling molecules defined by the presence of a common 500 aa Sema domain. They are best characterized in relation to axon guidance during development of the nervous system. The functions of Semaphorins 3A (SEMA3A) are mediated primarily through binding to the Neuropilin-1 (Npn-1) and Plexin-A1 coreceptor complex. Neuropilins lack a signaling-competent cytoplasetmic domain and ensure semaphorin binding, whereas the transmembrane receptor plexin mediates the intracellular response. As the first identified vertebrate semaphorin, SEMA3A functions either as a chemorepulsive agent inhibiting axonal outgrowth, or as a chemoattractive agent stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Its overexpression is associated with schizophrenia which is seen in various human tumor cell lines, and aberrant release is associated with the progression of Alzheimer's disease

  • Giordano,A. et al., 2003, J Neurocytol.32(4):345-352.
  • Good, P. F. et al., 2005, J. Neurochem.91(3): 716-736.
  • Gu, C. et al., 2005, Science.307(5707): 265–268.
  • Chadborn,N.H. et al., 2006, J Cell Sci.119(Pt 5):951-957.
  • Schmidt,E.F. et al., 2007, Adv Exp Med Biol.600:1-11.
  • Size / Price
    Catálogo: HG10758-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.