After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano SEMA6A clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human SEMA6A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_020796.3
Tamaño de cDNA:3093bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A.
Sinónimo de gen:VIA, SEMA, HT018, SEMAQ, SEMA6A1, KIAA1368, SEMA6A
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SEMA6A
Sitio de restricción:KpnI + NotI (6.1kb + 3.09kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human SEMA6A Gene Plasmid Map
Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Referencias
  • Klostermann A., et al., 2000, J. Biol. Chem. 275:39647-53.
  • Nagase T., et al., 2000, DNA Res. 7:65-73.
  • Schmutz J., et al., 2004, Nature 431:268-74.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Size / Price
    Catálogo: HG11189-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"