TBG / SERPINA7 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

TBG / SERPINA7 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TBG / SERPINA7 cDNA ORF Clone, Human, N-HA tag: Alternative Names

TBG cDNA ORF Clone, Human

TBG / SERPINA7 Background Information

Thyroxine-binding globulin, also known as T4-binding globulin, Serpin A7 and TBG, is a secreted protein which belongs to theserpin family. TBG is synthesized primarily in theliveras a 54 kDa protein.TBG is genomically aserpin, although it has no inhibitory function like many other members of this class of proteins. TBG binds thyroid hormone in circulation. It is one of three proteins(along with transthyretin and albumin) responsible for carrying thethyroidhormones thyroxine(T4) and 3,5,3’-triiodothyronine (T3) in the bloodstream. Of these three proteins, TBG has the highest affinity for T4 and T3, but is present in the lowest concentration. Despite its low concentration, TBG carries the majority of T4 inserum. Due to the very low serum concentration of T4 and T3, TBG is rarely more than 25% saturated with itsligand. Unlike transthyretin and albumin, TBG has a single binding site for T4/T3. TBG tests are sometimes used in finding the reason for elevated or diminished levels of thyroid hormone.
Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7
References
  • Flink I.L., et al.,(1986), Complete amino acid sequence of human thyroxine-binding globulin deduced from cloned DNA: close homology to the serine antiproteases. Proc. Natl. Acad. Sci. U.S.A. 83:7708-7712.
  • Akbari M.T., et al., (1993), The structure of the human thyroxine binding globulin (TBG) gene.Biochim. Biophys. Acta 1216:446-454.
  • Hayashi Y., et al.,(1993), Human thyroxine-binding globulin gene: complete sequence and transcriptional regulation.Mol. Endocrinol. 7:1049-1060.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait