Pedido rápido

Humano SESTD1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Humano SESTD1 Información de producto de clon de cDNA
Gene_bank_ref_id:BC047578
Tamaño de cDNA:2091bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens SEC14 and spectrin domains 1.
Sinónimo de gen:SOLO
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SESTD1 qPCR primers for gene expression analysis, HP103824 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15198-ACG$245
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15198-ACR$245
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15198-ANG$245
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15198-ANR$245
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15198-CF$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15198-CH$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15198-CM$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15198-CY$215
Humano SESTD1 clonación del ADN o clonación génica(Vector de expresión)HG15198-G$75
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15198-NF$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15198-NH$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15198-NM$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15198-NY$215
Humano SESTD1 clonación del ADN o clonación génica(vector de clonación)HG15198-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15198-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"