Pedido rápido

Text Size:AAA

Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SH2D1A Información de producto de clon de cDNA
Tamaño de cDNA:387bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens SH2 domain protein 1A with C terminal HA tag.
Sinónimo de gen:LYP, SAP, XLP, DSHP, EBVS, IMD5, XLPD, MTCP1, FLJ18687, FLJ92177, SH2D1A
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11149-ACG$225
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11149-ACR$225
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11149-ANG$225
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11149-ANR$225
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11149-CF$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11149-CH$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11149-CM$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11149-CY$195
Humano SH2D1A clonación del ADN o clonación génica(Vector de expresión)HG11149-M$75
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11149-M-F$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11149-NF$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11149-NH$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11149-NM$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11149-NY$195
Humano SH2D1A clonación del ADN o clonación génica(vector de clonación)HG11149-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

SH2 domain-containing protein 1A (SH2D1A / SAP) is a 128 amino acid protein, containing a single Src homology 2 (SH2) domain, flanked by 5 amino acids at the N-terminus and 25 amino acids at the C-terminus. The absence of a catalytic domain and the presence of an SH2 domain suggest that SH2D1A regulates one or more signal transduction pathways. SH2D1A interacts with signaling lymphocytic activation molecule (SLAM), which is a transmembrane protein expressed on the surface of activated T and B cells. SH2D1A (SAP) interacts via its SH2 domain with a motif (TIYXXV) present in the cytoplasmic tail of the cell-surface receptors, including CD150 / SLAM, CD84, CD229 / Ly-9, and CD244 / 2B4. SH2D1A was expressed in EBV-carrying, tumor phenotype representative (type I), but not in EBV-carrying lymphoblastoid cell line (LCL)-like (type III) or EBV-negative Burkitt lymphoma (BL) lines. It has been supposed to be related to the X-linked lymphoproliferative disease which is also known as Duncan's disease or Purtilo syndrome. 

  • Morra M, et al. (2005) Defective B cell responses in the absence of SH2D1A. PNAS. 102 (13): 4819-23.
  • Morra M, et al. (2001) Characterization of SH2D1A Missense Mutations Identified in X-linked Lymphoproliferative Disease Patients. The Journal of Biological Chemistry. 276: 36809-16.
  • Hron JD, et al. (2004) SH2D1A Regulates T-dependent Humoral Autoimmunity. JEM. 200 (2): 261-6.
  • Size / Price
    Catálogo: HG11149-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.