Pedido rápido

Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SIAE Información de producto de clon de cDNA
Tamaño de cDNA:1572bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens sialic acid acetylesterase with C terminal Flag tag.
Sinónimo de gen:LSE, AIS6, CSEC, YSG2, CSE-C, MGC87009, SIAE
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13310-ACG$245
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13310-ACR$245
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13310-CF$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13310-CH$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13310-CM$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13310-CY$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(Vector de expresión)HG13310-G$75
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13310-NF$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13310-NH$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13310-NM$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13310-NY$215
Humano sialate O-acetylesterase clonación del ADN o clonación génica(vector de clonación)HG13310-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Sialate O-acetylesterase belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. It is widely expressed with high expression in the testis, prostate, and colon. The systematic name of this enzyme class is N-acyl-O-acetylneuraminate O-acetylhydrolase. Other names in common use include N-acetylneuraminate acetyltransferase, sialate 9(4)-O-acetylesterase, and sialidase. Sialate O-acetylesterase catalyzes the removal of O-acetyl ester groups from position 9 of the parent sialic acid, N-acetylneuraminic acid. Defects in Sialate O-acetylesterase are a cause of autoimmune disease type 6 (AIS6). Individuals manifesting susceptibility to autoimmune disease type 6 can suffer from juvenile idiopathic arthritis, rheumatoid arthritis, multiple sclerosis, Sjogren syndrome, systemic lupus erythematosus, type 1 diabetes, ulcerative colitis, and Crohn disease.

  • Mandal C, et al. (2012) Regulation of O-acetylation of sialic acids by sialate-O-acetyltransferase and sialate-O-acetylesterase activities in childhood acute lymphoblastic leukemia. Glycobiology. 22(1): 70-83.
  • Tsai S, et al. (2011) Transcriptional profiling of human placentas from pregnancies complicated by preeclampsia reveals disregulation of sialic acid acetylesterase and immune signalling pathways. Placenta. 32 (2): 175-82.
  • Surolia I, et al. (2010) Functionally defective germline variants of sialic acid acetylesterase in autoimmunity. Nature. 466 (7303): 243-7.
  • Size / Price
    Catálogo: HG13310-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.