After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human SLAIN1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001040153.2
Tamaño de cDNA:1050bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens SLAIN motif family, member 1.
Sinónimo de gen:C13orf32, FLJ30046, MGC131899, SLAIN1
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SLAIN1
Sitio de restricción:KpnI + XbaI (6.1kb + 1.05kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human SLAIN1 Gene Plasmid Map
Human SLAIN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11197-ACG$225
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11197-ACR$225
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11197-ANG$225
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11197-ANR$225
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11197-CF$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11197-CH$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11197-CM$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11197-CY$195
Humano SLAIN1 clonación del ADN o clonación génica(Vector de expresión)HG11197-M$75
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11197-M-F$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11197-NF$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11197-NH$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11197-NM$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11197-NY$195
Humano SLAIN1 clonación del ADN o clonación génica(vector de clonación)HG11197-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11197-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human SLAIN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"