Pedido rápido

Text Size:AAA

Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SLC25A3 Información de producto de clon de cDNA
Tamaño de cDNA:1086bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 with C terminal His tag.
Sinónimo de gen:PHC, PTP, OK/SW-cl.48
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG16337-ACG$225
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG16337-ACR$225
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG16337-ANG$225
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG16337-ANR$225
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG16337-CF$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG16337-CH$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG16337-CM$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG16337-CY$195
Humano SLC25A3 clonación del ADN o clonación génica(Vector de expresión)HG16337-G$75
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG16337-NF$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG16337-NH$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG16337-NM$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG16337-NY$195
Humano SLC25A3 clonación del ADN o clonación génica(vector de clonación)HG16337-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG16337-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.