After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human DIABLO Información de producto de clon de cDNA
Gene_bank_ref_id:NM_019887.3
Tamaño de cDNA:720bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with C terminal Flag tag.
Sinónimo de gen:SMAC, SMAC3, DIABLO-S, FLJ10537, FLJ25049
Especie:Human
Vector:pCMV3-C-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10339-ACG$225
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10339-ACR$225
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10339-ANG$225
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10339-ANR$225
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10339-CF$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10339-CH$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10339-CM$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10339-CY$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10339-M$75
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10339-M-F$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10339-NF$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10339-NH$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10339-NM$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10339-NY$195
Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10339-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

Referencias
  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • Size / Price
    Catálogo: HG10339-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"