Pedido rápido

Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano DIABLO Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_019887.3
    Tamaño de cDNA:720bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens diablo homolog (Drosophila), nuclear gene encoding mitochondrial protein, transcript variant 1 with C terminal Flag tag.
    Sinónimo de gen:SMAC, SMAC3, DIABLO-S, FLJ10537, FLJ25049
    Especie:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIABLO qPCR primers for gene expression analysis, HP100033 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10339-ACG$225
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10339-ACR$225
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10339-ANG$225
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10339-ANR$225
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10339-CF$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10339-CH$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10339-CM$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10339-CY$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10339-M$75
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10339-M-F$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10339-NF$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10339-NH$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10339-NM$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10339-NY$195
    Humano SMAC/Diablo transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10339-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Apoptosis is an essential processes required for normal development and homeostasis of all metazoan organisms. Second Mitochondria-Derived Activator of Caspases (Smac) or Direct IAP Binding Protein with low isoelectric point, pI (Diablo) is a proapoptogenic mitochondrial protein that is released to the cytosol in response to diverse apoptotic stimuli, including commonly used chemotherapeutic drugs. The current knowlege about structure and function of Smac/Diablo during programmed cell death, both in mitochondrial and receptor pathways are presented. It has been shown that Diablo mainly interacts with IAPs in the cytochrome c/Apaf-1/caspase-9 pathway, and promotes apoptosis. Diablo is released from the mitochondria into the cytosol occurring downstream of cytochrome c release in response to apoptotic stimuli such as irradiation, DNA damage or cytotoxic drugs. In the cytosol, Smac/Diablo interacts and antagonizes inhibitors of apoptosis proteins (IAPs), thus allowing the activation of caspases and apoptosis. This activity has prompted the synthesis of peptidomimetics that could potentially be used in cancer therapy. The role of Smac/DIABLO in colorectal carcinogenesis is ill defined. Data continues to accumulate to suggest that decreased levels of Smac/DIABLO may be important in chemoradiation-resistance to apoptosis in advanced colon cancer.

    Referencias
  • Korga A, et al. (2006) Role of mitochondrial protein Smac/Diablo in regulation of apoptotic pathways Pol Merkur Lekarski. 20(119): 573-6.
  • Anguiano-Hernandez YM, et al. (2007) Smac/DIABLO and colon cancer. Anticancer Agents Med Chem. 7(4): 467-73.
  • Martinez-Ruiz G, et al. (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res. 27: 48.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"