After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human SNAI2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003068.3
Tamaño de cDNA:807bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens snail homolog 2 (Drosophila).
Sinónimo de gen:SLUG, WS2D, SLUGH1, MGC10182, SNAI2
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SNAI2
Sitio de restricción:KpnI + NotI (6.1kb + 0.81kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human SNAI2 Gene Plasmid Map
Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11196-ACG$225
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11196-ACR$225
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11196-ANG$225
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11196-ANR$225
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11196-CF$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11196-CH$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11196-CM$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11196-CY$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(Vector de expresión)HG11196-M$75
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11196-M-F$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11196-NF$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11196-NH$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11196-NM$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11196-NY$195
Humano SNAI2 / Snail2 / slug clonación del ADN o clonación génica(vector de clonación)HG11196-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG11196-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human SNAI2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"