After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SPATA24 Información de producto de clon de cDNA
Gene_bank_ref_id:BC050563
Tamaño de cDNA:567bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens spermatogenesis associated 24 with C terminal His tag.
Sinónimo de gen:T6441, CCDC161
Especie:Human
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15150-ACG$225
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15150-ACR$225
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15150-ANG$225
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15150-ANR$225
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15150-CF$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15150-CH$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15150-CM$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15150-CY$195
Humano SPATA24 clonación del ADN o clonación génica(Vector de expresión)HG15150-G$75
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15150-NF$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15150-NH$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15150-NM$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15150-NY$195
Humano SPATA24 clonación del ADN o clonación génica(vector de clonación)HG15150-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15150-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"