Pedido rápido

Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SPG21 Información de producto de clon de cDNA
Tamaño de cDNA:927bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1 with N terminal HA tag.
Sinónimo de gen:MAST, ACP33, GL010, BM-019, MASPARDIN
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10522-ACG$225
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10522-ACR$225
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10522-ANG$225
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10522-ANR$225
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10522-CF$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10522-CH$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10522-CM$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10522-CY$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10522-M$75
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10522-M-F$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10522-NF$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10522-NH$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10522-NM$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10522-NY$195
Humano SPG21 transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10522-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • Size / Price
    Catálogo: HG10522-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.