Pedido rápido

Text Size:AAA

Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SSSCA1 Información de producto de clon de cDNA
Tamaño de cDNA:600bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens Sjogren syndrome/scleroderma autoantigen 1 with N terminal HA tag.
Sinónimo de gen:p27
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10521-ACG$225
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10521-ACR$225
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10521-ANG$225
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10521-ANR$225
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10521-CF$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10521-CH$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10521-CM$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10521-CY$195
Humano SSSCA1 clonación del ADN o clonación génica(Vector de expresión)HG10521-M$75
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10521-M-F$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10521-NF$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10521-NH$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10521-NM$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10521-NY$195
Humano SSSCA1 clonación del ADN o clonación génica(vector de clonación)HG10521-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10521-NY
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.