ST3GAL2 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ST3GAL2 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human ST3 beta-galactoside alpha-2,3-sialyltransferase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ST3GAL2 cDNA ORF Clone, Human, N-His tag: Alternative Names

Gal-NAc6S cDNA ORF Clone, Human; SIAT4B cDNA ORF Clone, Human; ST3GalA.2 cDNA ORF Clone, Human; ST3GALII cDNA ORF Clone, Human

ST3GAL2 Background Information

Full Name
ST3 beta-galactoside alpha-2,3-sialyltransferase 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait