After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano STC2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human STC2 Información de producto de clon de cDNA
Gene_bank_ref_id:BC000658
Tamaño de cDNA:909bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens stanniocalcin 2 with N terminal His tag.
Sinónimo de gen:STC-2, STCRP, STC2
Especie:Human
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fondo

STC2 is a secreted, homodimeric glycoprotein which expressed in a wide variety of tissues. STC2 has an anti-hypocalcemic action on calcium and phosphate homeostasis. It may have autocrine or paracrine functions. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. STC2 has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. It may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis.

Referencias
  • Chang AC, et al. (1998) Identification of a second stanniocalcin cDNA in mouse and human: stanniocalcin 2. Mol Cell Endocrinol. 141(1-2):95-9.
  • Ishibashi K, et al. (1998) Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun. 250(2):252-8.
  • uo CW, et al. (2005) Identification of a stanniocalcin paralog, stanniocalcin-2, in fish and the paracrine actions of stanniocalcin-2 in the mammalian ovary. Endocrinology. 146(1):469-76.
  • Size / Price
    Catálogo: HG13653-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"