After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SUMO1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003352.4
Tamaño de cDNA:306bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens small ubiquitin-like modifier 1 with N terminal Myc tag.
Sinónimo de gen:DAP1, GMP1, PIC1, SMT3, UBL1, OFC10, SENP2, SMT3C, SMT3H3
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13095-ACG$225
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13095-ACR$225
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13095-ANG$225
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13095-ANR$225
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13095-CF$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13095-CH$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13095-CM$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13095-CY$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(Vector de expresión)HG13095-G$75
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13095-NF$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13095-NH$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13095-NM$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13095-NY$195
Humano SUMO1/SUMO-1 clonación del ADN o clonación génica(vector de clonación)HG13095-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

Referencias
  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.
  • Size / Price
    Catálogo: HG13095-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"