After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human SYT6 Información de producto de clon de cDNA
Gene_bank_ref_id:BC044948
Tamaño de cDNA:1278bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens synaptotagmin VI DNA.
Sinónimo de gen:sytVI
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG15218-ACG$225
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG15218-ACR$225
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG15218-ANG$225
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG15218-ANR$225
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG15218-CF$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG15218-CH$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG15218-CM$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG15218-CY$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(Vector de expresión)HG15218-G$75
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG15218-NF$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG15218-NH$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG15218-NM$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG15218-NY$195
Humano SYT6 / Synaptotagmin VI clonación del ADN o clonación génica(vector de clonación)HG15218-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG15218-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"