After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano TBCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human TBCB Información de producto de clon de cDNA
Gene_bank_ref_id:BC005969
Tamaño de cDNA:735bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens tubulin folding cofactor B with N terminal His tag.
Sinónimo de gen:CG22, CKAP1, CKAPI, MGC14625
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano TBCB clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name
Fondo

Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

Referencias
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • Size / Price
    Catálogo: HG14260-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"