Pedido rápido

Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

  • Cynomolgus LOC101926731 Gene Plasmid Map 5628
Hoja de datosReseñasProductos relacionadosProtocolos
Humano TCF4 Información de producto de clon de cDNA
Tamaño de cDNA:2058 bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens transcription factor 4 with N terminal HA tag.
Sinónimo de gen:bHLHb19,E2-2,ITF-2,ITF2,PTHS,SEF-2,SEF2,SEF2-1,SEF2-1A,SEF2-1B,SEF2-1D,TCF-4
Sitio de restricción:KpnI + XbaI(6kb+2.06kb)
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
( We provide with TCF4 qPCR primers for gene expression analysis, HP101624 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12096-ACG$245
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12096-ACR$245
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12096-ANG$245
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12096-ANR$245
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12096-CF$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12096-CH$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12096-CM$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12096-CY$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(Vector de expresión)HG12096-G$75
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12096-NF$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12096-NH$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12096-NM$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12096-NY$215
Humano TCF4/E2-2 clonación del ADN o clonación génica(vector de clonación)HG12096-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG12096-NY
Precio de lista: 
Precio:      (You Save: )
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.