After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human TFAP2C Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003222.3
Tamaño de cDNA:1353bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) with N terminal Myc tag.
Sinónimo de gen:ERF1, TFAP2G, hAP-2g, AP2-GAMMA, TFAP2C
Especie:Human
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG13115-ACG$225
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG13115-ACR$225
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG13115-ANG$225
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG13115-ANR$225
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG13115-CF$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG13115-CH$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG13115-CM$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG13115-CY$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(Vector de expresión)HG13115-G$75
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG13115-NF$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG13115-NH$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG13115-NM$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG13115-NY$195
Humano TFAP2C / AP2-GAMMA clonación del ADN o clonación génica(vector de clonación)HG13115-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

TFAP2C, also known as AP2-GAMMA, is a member of the activating protein 2 family of transcription factors. AP-2 factors bind to the consensus sequence 5'-GCCNNNGGC-3' and activate genes involved in a large spectrum of important biological functions including proper eye, face, body wall, limb and neural tube development. They also suppress a number of genes including MCAM/MUC18, C/EBP alpha and MYC. TFAP2C may be prognostic indicators for patients with breast tumors. TFAP2C gene has been tested for association to diseases (Breast Neoplasms; Carcinoma) and proposed to participate in processes (cell-cell signaling, male gonad development, regulation of transcription from RNA polymerase II promoter). Proteins are expected to have molecular functions (DNA binding, protein binding, protein dimerization activity, transcription factor activity) and to localize in various compartments (membrane, nucleus).

Referencias
  • Woodfield GW, et al. (2009) Interaction of TFAP2C with the estrogen receptor-alpha promoter is controlled by chromatin structure. Clin Cancer Res. 15 (11): 3672-9.
  • Zhao C, et al. (2003) Elevated expression levels of NCOA3, TOP1, and TFAP2C in breast tumors as predictors of poor prognosis. Cancer. 98 (1): 18-23.
  • Woodfield GW, et al. (2007) TFAP2C controls hormone response in breast cancer cells through multiple pathways of estrogen signaling. Cancer Res. 67 (18): 8439-43.
  • Penna E, et al. (2011) microRNA-214 contributes to melanoma tumour progression through suppression of TFAP2C. EMBO J. 30 (10): 1990-2007.
  • Woodfield GW, et al. (2010) Identification of primary gene targets of TFAP2C in hormone responsive breast carcinoma cells. Genes Chromosomes Cancer. 49 (10): 948-62.
  • Size / Price
    Catálogo: HG13115-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"