Pedido rápido

Text Size:AAA

Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human TGFBR2 Información de producto de clon de cDNA
Tamaño de cDNA:1704bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens transforming growth factor, beta receptor II (70/80kDa), transcript variant 2 with C terminal Flag tag.
Sinónimo de gen:AAT3, FAA3, MFS2, RIIC, LDS1B, LDS2B, TAAD2, TGFR-2, TGFbeta-RII
Sitio de restricción:KpnI + XbaI (6kb + 1.75kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human TGFBR2 Gene Plasmid Map
Human TGFβR2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human TGFBR2 Gene Expression validated Image
Human TGFβR2 transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
[Hacer clic para ampliar la imagen]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10358-ACG$245
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10358-ACR$245
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10358-CF$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10358-CH$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10358-CM$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10358-CY$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)HG10358-M$75
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10358-NF$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10358-NH$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10358-NM$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10358-NY$215
Humano TGFBR2 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)HG10358-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.

  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
  • Size / Price
    Catálogo: HG10358-CF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human TGFβR2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human TGFβR2 transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.