Pedido rápido

Humano TGF-beta 1/TGFB1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano TGFB1 Información de producto de clon de cDNA
    Tamaño de cDNA:1173bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens transforming growth factor, beta 1 with N terminal Myc tag.
    Sinónimo de gen:CED, DPD1, TGFB, TGFbeta, TGFB1
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with TGFB1 qPCR primers for gene expression analysis, HP100717 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano TGF-beta 1/TGFB1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
    Product nameProduct name

    TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
  • Size / Price
    Catálogo: HG10804-NM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.