TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Price:
Size:
Number:

TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Human transmembrane and immunoglobulin domain containing 2, transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TMIGD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

IGPR-1 cDNA ORF Clone, Human; IGPR1 cDNA ORF Clone, Human; TMIGD2 cDNA ORF Clone, Human; TPC1 cDNA ORF Clone, Human

TMIGD2 Background Information

The orthologue of human IGPR-1 is found only in eukaryotes, including primates, the guinea pig, canines, felines, dolphins, bovines, the llama, bats, the common shrew, and horses. Of interest, the IGPR-1 gene is absent in mouse and rat genomes. The immunoglobulin domain of IGPR-1 was predicted to be Ig V (variable) fold and was found to be highly similar to the Ig domain of myelin-associated glycoprotein.
Full Name
transmembrane and immunoglobulin domain containing 2
References
  • Rahimi N, Rezazadeh K, Mahoney JE, Hartsough E, Meyer RD. Identification of IGPR-1 as a novel adhesion molecule involved in angiogenesis. Nusrat A, ed. Molecular Biology of the Cell. 2012;23(9):1646-1656.

TMIGD2 cDNA ORF Clone, Human, Related Products

TMIGD2 cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait