Pedido rápido

Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human TNFRSF10B Información de producto de clon de cDNA
Tamaño de cDNA:1323bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 10b with C terminal His tag.
Sitio de restricción:KpnI + NotI (6kb + 1.37kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human TNFRSF10B Gene Plasmid Map
Human TNFRSF10B / TRAILR2 natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10465-ACG$225
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10465-ACR$225
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10465-CF$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10465-CH$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10465-CM$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10465-CY$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(Vector de expresión)HG10465-M$75
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10465-NF$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10465-NH$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10465-NM$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10465-NY$195
Humano TRAIL R2/CD262/TNFRSF10B clonación del ADN o clonación génica(vector de clonación)HG10465-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Catálogo: HG10465-CH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human TNFRSF10B / TRAILR2 natural ORF mammalian expression plasmid, C-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.