TOR3A cDNA ORF Clone, Human, N-Myc tag

Cat: HG13289-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All TOR3A Reagents

CRO Services

Product recommended


All TOR3A Reagents

TOR3A cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Human torsin family 3, member A with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOR3A cDNA ORF Clone, Human, N-Myc tag Alternative Names

ADIR cDNA ORF Clone, Human;ADIR2 cDNA ORF Clone, Human

TOR3A Background Information

Full Name
torsin family 3, member A

TOR3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOR3A cDNA ORF Clone in Cloning Vector, Mouse MG53888-U
TOR3A cDNA ORF Clone, Mouse, untagged MG53888-UT
TOR3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53888-ACG
TOR3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53888-ACGLN
TOR3A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53888-ANG
TOR3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53888-ACR
TOR3A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53888-ANR
TOR3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53888-CF
TOR3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53888-NF
TOR3A cDNA ORF Clone, Mouse, C-His tag MG53888-CH
TOR3A cDNA ORF Clone, Mouse, N-His tag MG53888-NH
TOR3A cDNA ORF Clone, Mouse, C-HA tag MG53888-CY
TOR3A cDNA ORF Clone, Mouse, N-HA tag MG53888-NY
TOR3A cDNA ORF Clone, Mouse, C-Myc tag MG53888-CM
TOR3A cDNA ORF Clone, Mouse, N-Myc tag MG53888-NM

TOR3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOR3A cDNA ORF Clone in Cloning Vector, Human HG13289-G
TOR3A cDNA ORF Clone, Human, untagged HG13289-UT
TOR3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13289-ACGLN
TOR3A cDNA ORF Clone, Human, C-GFPSpark® tag HG13289-ACG
TOR3A cDNA ORF Clone, Human, N-GFPSpark® tag HG13289-ANG
TOR3A cDNA ORF Clone, Human, C-OFPSpark® tag HG13289-ACR
TOR3A cDNA ORF Clone, Human, N-OFPSpark® tag HG13289-ANR
TOR3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13289-CF
TOR3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13289-NF
TOR3A cDNA ORF Clone, Human, C-His tag HG13289-CH
TOR3A cDNA ORF Clone, Human, N-His tag HG13289-NH
TOR3A cDNA ORF Clone, Human, C-HA tag HG13289-CY
TOR3A cDNA ORF Clone, Human, N-HA tag HG13289-NY
TOR3A cDNA ORF Clone, Human, C-Myc tag HG13289-CM
TOR3A qPCR Primer Pairs, Human HP101997
info info
添加购物车成功! 添加购物车失败!