Pedido rápido

Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano TSPAN7 Información de producto de clon de cDNA
    Gene_bank_ref_id:BC018036
    Tamaño de cDNA:750bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens tetraspanin 7 with N terminal HA tag.
    Sinónimo de gen:A15, MXS1, CD231, MRX58, CCG-B7, TM4SF2, TALLA-1, TM4SF2b, DXS1692E, TSPAN7
    Especie:Human
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TSPAN7 qPCR primers for gene expression analysis, HP102687 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG14031-ACG$225
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG14031-ACR$225
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG14031-CF$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG14031-CH$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG14031-CM$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG14031-CY$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(Vector de expresión)HG14031-G$75
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG14031-NF$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG14031-NH$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG14031-NM$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG14031-NY$195
    Humano TALLA-1 / TSPAN7 (CD231) clonación del ADN o clonación génica(vector de clonación)HG14031-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

    Referencias
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • Size / Price
    Catálogo: HG14031-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"