Pedido rápido

Text Size:AAA

Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human TTR Información de producto de clon de cDNA
Tamaño de cDNA:444bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens transthyretin with N terminal HA tag.
Sinónimo de gen:HsT2651
Sitio de restricción:KpnI + NotI (6kb + 0.47kb)
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human TTR Gene Plasmid Map
Human TTR ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12091-ACG$225
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12091-ACR$225
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12091-CF$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12091-CH$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12091-CM$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12091-CY$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(Vector de expresión)HG12091-G$75
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12091-NF$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12091-NH$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12091-NM$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12091-NY$195
Humano Prealbumin/Transthyretin clonación del ADN o clonación génica(vector de clonación)HG12091-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Prealbumin/Transthyretin, also known as ATTR, Prealbumin, TTR and PALB, is a secreted and cytoplasm protein which belongs to the Prealbumin / Transthyretin family. Prealbumin / Transthyretin is detected in serum and cerebrospinal fluid (at protein level). It is highly expressed in choroid plexus epithelial cells. It is also detected in retina pigment epithelium and liver. Each monomer of Prealbumin / Transthyretin has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel. Prealbumin/Transthyretin is a carrier protein. It transports thyroid hormones in the plasma and cerebrospinal fluid, and also transports retinol (vitamin A) in the plasma. Defects in Prealbumin / Transthyretin are the cause of amyloidosis type 1 (AMYL1) which is a hereditary generalized amyloidosis due to Prealbumin / Transthyretin amyloid deposition. Protein fibrils can form in different tissues leading to amyloid polyneuropathies, amyloidotic cardiomyopathy, carpal tunnel syndrome, systemic senile amyloidosis. The diseases caused by mutations include amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis, carpal tunnel syndrome, etc.

  • Westermark P, et al. (1990) Fibril in senile systemic amyloidosis is derived from normal transthyretin. Proc Natl Acad Sci U S A. 87(7): 2843-5.
  • Colon W, et al. (1992) Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry. 31(36): 8654-60.
  • Hammarstrm P, et al. (2003) Prevention of transthyretin amyloid disease by changing protein misfolding energetics. Science. 299(5607): 713-6.
  • Size / Price
    Catálogo: HG12091-NY
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Human TTR ORF mammalian expression plasmid, N-HA tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.