Pedido rápido

Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Humano UBE3A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_130838.1
    Tamaño de cDNA:2559bp
    Descripción de cDNA:Full length Clone DNA of Homo sapiens ubiquitin protein ligase E3A, transcript variant 1 with C terminal His tag.
    Sinónimo de gen:AS, ANCR, E6-AP, HPVE6A, EPVE6AP, FLJ26981, UBE3A
    Especie:Human
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with UBE3A qPCR primers for gene expression analysis, HP101041 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11130-ACG$325
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11130-ACR$325
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11130-ANG$325
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11130-ANR$325
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11130-CF$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11130-CH$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11130-CM$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11130-CY$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG11130-M$75
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11130-M-N$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11130-NF$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11130-NH$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11130-NM$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11130-NY$295
    Humano E6AP transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG11130-UT$295
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: HG11130-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"