After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human USH1C Información de producto de clon de cDNA
Gene_bank_ref_id:NM_005709.2
Tamaño de cDNA:1659bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens Usher syndrome 1C (autosomal recessive, severe), transcript variant 1 with C terminal Myc tag.
Sinónimo de gen:PDZ73, AIE-75, DFNB18, PDZ-45, PDZ-73, NY-CO-37, NY-CO-38, ush1cpst, PDZ-73/NY-CO-38
Especie:Human
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10613-ACG$245
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10613-ACR$245
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10613-ANG$245
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10613-ANR$245
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10613-CF$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10613-CH$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10613-CM$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10613-CY$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10613-M$75
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10613-M-F$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10613-NF$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10613-NH$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10613-NM$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10613-NY$215
Humano USH1C/Harmonin transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10613-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Harmonin, also known as Antigen NY-CO-38 / NY-CO-37, Autoimmune enteropathy-related antigen AIE-75, Protein PDZ-73, Renal carcinoma antigen NY-REN-3, Usher syndrome type-1C protein and USH1C, is a protein which is expressed in small intestine, colon, kidney, eye and weakly in pancreas. USH1C is expressed also in vestibule of the inner ear. USH1C contains 3 PDZ (DHR) domains. USH1C may be involved in protein-protein interaction. Defects in USH1C are the cause of Usher syndrome type 1C (USH1C), also known as Usher syndrome type I Acadian variety. USH is a genetically heterogeneous condition characterized by the association of retinitis pigmentosa and sensorineural deafness. Age at onset and differences in auditory and vestibular function distinguish Usher syndrome type 1 (USH1), Usher syndrome type 2 (USH2) and Usher syndrome type 3 (USH3). Defects in USH1C are also the cause of deafness autosomal recessive type 18 (DFNB18) which is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Referencias
  • Verpy, E. et al., 2000, Nat Genet. 26 (1):51-5.
  • Weil D., et al., 2003, Hum. Mol. Genet. 12:463-471.
  • Reiners,J. et al., 2005, Hum Mol Genet. 14 (24):3933-43.
  • Yan,D. et al., 2006, Mol Biol. 357 (3):755-64.
  • Size / Price
    Catálogo: HG10613-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"