After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human SCGB1A1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_003357.3
Tamaño de cDNA:276bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens secretoglobin, family 1A, member 1 (uteroglobin) with N terminal Myc tag.
Sinónimo de gen:UGB, CC10, CC16, CCSP, SCGB1A1
Especie:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10808-ACG$225
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10808-ACR$225
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10808-CF$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10808-CH$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10808-CM$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10808-CY$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(Vector de expresión)HG10808-M$75
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10808-M-F$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10808-NF$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10808-NH$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10808-NM$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10808-NY$195
Humano Uteroglobin/SCGB1A1 clonación del ADN o clonación génica(vector de clonación)HG10808-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Uteroglobin (UG), also known as Secretoglobin 1A member 1 (SCGB1A1), Blastokinin, Clara cell secretor protein (CCSP) or Clara cell-specific 10-kDa protein (CC10), is the founding member of the secretoglobin family of small, secreted, disulfide-bridged dimeric proteins found only in mammals. This protein is mainly expressed in lung, with anti-inflammatory/immunomodulatory properties. Previous in vitro studies demonstrated that CCAAT/enhancer-binding proteins (C/EBPs) are the major transcription factors for the regulation of SCGB1A1 gene expression, whereas FOXA1 had a minimum effect on the transcription. Uteroglobin is a multifunctional protein with antiinflammatory/immunomodulatory properties. Uteroglobin inhibits soluble phospholipase A(2) activity and binds and perhaps sequesters hydrophobic ligands such as progesterone, retinols, polychlorinated biphenyls, phospholipids, and prostaglandins. In addition to its antiinflammatory activities, Uteroglobin manifests antichemotactic, antiallergic, antitumorigenic, and embryonic growth-stimulatory activities. The tissue-specific expression of the Uteroglobin gene is regulated by several steroid hormones, although a nonsteroid hormone, prolactin, further augments its expression in the uterus. Based on its anti-inflammatory and antiallergic properties, Uteroglobin is a potential drug target. The mechanism of Uteroglobin action is likely to be even more complex as it also functions via a putative receptor-mediated pathway.

Referencias
  • Mukherjee AB, et al. (1999). Uteroglobin: a novel cytokine? Cell Mol Life Sci. 55(5): 771-87.
  • Klug J, et al. (2000). Uteroglobin/Clara cell 10-kDa family of proteins: nomenclature committee report. Ann. N. Y. Acad. Sci. 923: 348-54.
  • Laukaitis CM, et al. (2005). Evolution of the secretoglobins: a genomic and proteomic view. Biological Journal of the Linnean Society. 84 (3): 493-501.
  • Mukherjee AB, et al. (2007). Uteroglobin: a steroid-inducible immunomodulatory protein that founded the Secretoglobin superfamily. Endocr Rev. 28(7): 707-25.
  • Kido T, et al. (2011). FOXA1 plays a role in regulating secretoglobin 1a1 expression in the absence of CCAAT/enhancer binding protein activities in lung in vivo. Am J Physiol Lung Cell Mol Physiol. 300(3): L441-52.
  • Size / Price
    Catálogo: HG10808-NM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"