After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human VAPB Información de producto de clon de cDNA
Gene_bank_ref_id:NM_004738.3
Tamaño de cDNA:732bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens VAMP (vesicle-associated membrane protein)-associated protein B and C with N terminal His tag.
Sinónimo de gen:ALS8, VAP-B, VAP-C, VAMP-B, VAMP-C, VAPB
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10754-ACG$225
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10754-ACR$225
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10754-ANG$225
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10754-ANR$225
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10754-CF$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10754-CH$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10754-CM$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10754-CY$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(Vector de expresión)HG10754-M$75
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10754-M-F$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10754-NF$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10754-NH$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10754-NM$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10754-NY$195
Humano VAPB/VAP-B clonación del ADN o clonación génica(vector de clonación)HG10754-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Vesicle-associated membrane protein-associated protein B / C, also known as VAMP-B/VAMP-C, VAMP-associated protein B/C, VAP-B/VAP-C and VAPB, is a single-pass type IV membrane protein which belongs to the VAMP-associated protein ( VAP ) family. VAPB contains one MSP domain. VAPB may play a role in vesicle trafficking. VAPB forms a heterodimer with VAPA. VAPB interacts with VAMP1 and VAMP2. Defects in VAPB are the cause of amyotrophic lateral sclerosis type 8 ( ALS8 ) which is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Defects in VAPB are also a cause of spinal muscular atrophy autosomal dominant Finkel type ( SMAF ) which is characterized by proximal muscle weakness that begins in the lower limbs and then progresses to upper limbs.

Referencias
  • Nishimura Y., et al., 1999, Biochem. Biophys. Res. Commun. 254:21-26.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Hamamoto I., et al., 2005, J. Virol. 79:13473-13482.
  • Choudhary C. et al., 2009, Science 325:834-840.
  • Size / Price
    Catálogo: HG10754-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"