After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human VDR Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000376.2
Tamaño de cDNA:1284bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens vitamin D (1,25- dihydroxyvitamin D3) receptor.
Sinónimo de gen:NR1I1, VDR
Especie:Human
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG12025-ACG$225
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG12025-ACR$225
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG12025-ANG$225
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG12025-ANR$225
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG12025-CF$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG12025-CH$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG12025-CM$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG12025-CY$195
Humano VDR-NR111 clonación del ADN o clonación génica(Vector de expresión)HG12025-G$75
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación)HG12025-G-N$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG12025-NF$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG12025-NH$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG12025-NM$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG12025-NY$195
Humano VDR-NR111 clonación del ADN o clonación génica(vector de clonación)HG12025-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

VDR (vitamin D(1,25- dihydroxyvitamin D3)receptor), also known as NR1I1, belongs to the NR1I family, NR1 subfamily. It is composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal ligand-binding domain. Vitamin D receptors (VDRs) are members of the NR1I family, which also includes pregnane X (PXR) and constitutive androstane (CAR) receptors, that form heterodimers with members of the retinoid X receptor family. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. Also, it has recently been identified as an additional bile acid receptor alongside FXR and may function to protect gut against the toxic and carcinogenic effects of these endobiotics. VDR is expressed in the intestine, thyroid and kidney and has a vital role in calcium homeostasis. It is the nuclear hormone receptor, also called transcription factor that mediates the action of vitamin D3. Inherited mutations in the VDR gene leads to rickets.

Referencias
  • Moore DD, et al. (2006) The NR1H and NR1I receptors: constitutive androstane receptor, pregnene X receptor, farnesoid X receptor alpha, farnesoid X receptor beta, liver X receptor alpha, liver X receptor beta, and vitamin D receptor. Pharmacol Rev. 58(4):742-59.
  • Szpirer J, et al. (1991)The Sp1 transcription factor gene (SP1) and the 1,25-dihydroxyvitamin D3 receptor gene (VDR) are colocalized on human chromosome arm 12q and rat chromosome 7. Genomics. 11(1):168-73.
  • Germain P, et al. (2006) Overview of nomenclature of nuclear receptors. Pharmacol Rev. 58(4): 685-704.
  • Adorini L, et al. (2006) Vitamin D receptor agonists, cancer and the immune system: an intricate relationship. Curr Top Med Chem. 6(12):1297-301.
  • Luderer HF, et al. (2010) The vitamin D receptor, the skin and stem cells. J Steroid Biochem Mol Biol. 121(1-2):314-6.
  • Size / Price
    Catálogo: HG12025-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"