Pedido rápido

Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

  • Human VTCN1 ORF mammalian expression plasmid, N-His tag
Hoja de datosReseñasProductos relacionadosProtocolos
Humano VTCN1 Información de producto de clon de cDNA
Tamaño de cDNA:849bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens V-set domain containing T cell activation inhibitor 1 with N terminal His tag.
Sinónimo de gen:B7X, B7H4, B7S1, B7-H4, B7h.5, VCTN1, PRO1291, FLJ22418, RP11-229A19.4, VTCN1
Sitio de restricción:KpnI + XbaI (6kb + 0.87kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
( We provide with VTCN1 qPCR primers for gene expression analysis, HP100674 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Humano VTCN1 Gene Plasmid Map
Human VTCN1 ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10738-ACG$225
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10738-ACR$225
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10738-CF$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10738-CH$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10738-CM$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10738-CY$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(Vector de expresión)HG10738-M$75
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación)HG10738-M-N$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10738-NF$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10738-NH$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10738-NM$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10738-NY$195
Humano B7-H4/Vtcn1/B7S1 clonación del ADN o clonación génica(vector de clonación)HG10738-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

V-set domain-containing T-cell activation inhibitor 1, also known as B7X, B7H4, B7S1, and VTCN1, is a single-pass type? membrane protein belonging to the B7 family of costimulatory proteins. These proteins are expressed on the surface of antigen-presenting cells and interact with ligands on T lymphocytes. They provide costimulatory signals that regulate T cell responses. A soluble form of B7H4 has also been detected. B7X / VTCN1 / B7H4 negatively regulates T-cell-mediated immune response by inhibiting T-cell activation, proliferation, cytokine production and development of cytotoxicity. When expressed on the cell surface of tumor macrophages, B7X / VTCN1 / B7H4 plays an important role, together with regulatory T-cells(Treg), in the suppression of tumor-associated antigen-specific T-cell immunity. B7X / VTCN1 / B7H4 is also involved in promoting epithelial cell transformation. This membrane protein can be up-regulated by IL6 / interleukin-6 and IL10 / interleukin-10 and inhibited by CSF2 / GM-CSF and IL4 / interleukin-4 on antigen-presenting cells.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Zang X, et al. (2003) B7x: a widely expressed B7 family member that inhibits T cell activation. Proc Natl Acad Sci U S A. 100(18): 10388-92.
  • Suh WK, et al. (2006) Generation and characterization of B7-H4/B7S1/B7x-deficient mice. Mol Cell Biol. 26(17): 6403-11.
  • Zang X, et al. (2007) B7-H3 and B7x are highly expressed in human prostate cancer and associated with disease spread and poor outcome. Proc Natl Acad Sci U S A. 104(49):19458-63.
  • Size / Price
    Catálogo: HG10738-NH
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.