After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Humano VWC2 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human VWC2 Información de producto de clon de cDNA
Tamaño de cDNA:978bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens von Willebrand factor C domain containing 2 with C terminal HA tag.
Sinónimo de gen:PSST739, UNQ739
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Brorin, also known as brain-specific chordin-like protein, von Willebrand factor C domain-containing protein 2 and VWC2, is a secreted protein which contains two VWFC domains. VWC2 / Brorin is a BMP antagonist which may play a role in neural development. It promotes cell adhesion. VWC2 / Brorin is a unique member of the chordin family. It inhibited the activity of bone morphogenetic protein 2 (BMP2) and BMP6 in mouse preosteoblastic MC3T3-E1 cells. Mouse Brorin was predominantly expressed in neural tissues in embryos and also predominantly expressed in the adult brain. In the brain, the expression was detected in neurons, but not glial cells. The neural tissue-specific expression profile of Brorin is quite distinct from that of any other member of the Chordin family. VWC2 / Brorin protein promoted neurogenesis, but not astrogenesis, in mouse neural precursor cells. VWC2 / Brorin is a novel secreted BMP antagonist that potentially plays roles in neural development and functions.

  • Koike,N. et al., 2007, J Biol Chem. 282 (21):15843-50.
  • Elis,S. et al., 2009,Mol Reprod Dev. 76 (11):1043-55.
  • Zhang,J.L. et al., 2010,PLoS One. 5 (9):e12846.
  • Size / Price
    Catálogo: HG12071-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.