After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Wnt4 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human WNT4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_030761.4
Tamaño de cDNA:1056bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens wingless-type MMTV integration site family, member 4.
Sinónimo de gen:WNT-4, SERKAL, WNT4
Especie:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-WNT4
Sitio de restricción:KpnI + XbaI (6.1kb + 1.06kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human WNT4 Gene Plasmid Map
Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catálogo: HG10674-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Human WNT-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Artículos vistos recientemente
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"