After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human ZAP70 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001079.3
Tamaño de cDNA:1860bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens zeta-chain (TCR) associated protein kinase 70kDa, transcript variant 1 with N terminal His tag.
Sinónimo de gen:ZAP70, SRK, STD, TZK, ZAP-70, FLJ17670, FLJ17679
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10116-ACG$245
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10116-ACR$245
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10116-ANG$245
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10116-ANR$245
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10116-CF$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10116-CH$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10116-CM$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10116-CY$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)HG10116-M$75
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10116-NF$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10116-NH$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10116-NM$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10116-NY$215
Humano ZAP transcript variant 1 clonación del ADN o clonación génica(vector de clonación)HG10116-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10116-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"