After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Human EIF2A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_032025.3
Tamaño de cDNA:1758bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with N terminal His tag.
Sinónimo de gen:EIF2A, CDA02, EIF-2A, MST089, MSTP004, MSTP089
Especie:Human
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG10112-ACG$245
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG10112-ACR$245
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG10112-ANG$245
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG10112-ANR$245
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10112-CF$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG10112-CH$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG10112-CM$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG10112-CY$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(Vector de expresión)HG10112-M$75
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG10112-M-F$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG10112-NF$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG10112-NH$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG10112-NM$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG10112-NY$215
Humano eIF2A/eIF2 alpha clonación del ADN o clonación génica(vector de clonación)HG10112-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: HG10112-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"